Day_4A.ipynb

Kernel: Python 2 (SageMath)

Regex – Introduction

• Keep it simple: Operators

• Example:

  • Find EcoRI restriction enzyme site in sequence:

string = "TGCATAGCGAATTCGGACGT"
"GAATTC" in string

True

• Find Eco13kl restriction site in sequence

• CCNGG --> CCAGG, CCCGG, CCGGG or CCTGG

string = "CCTGGAGCCCAGGGGACGT"
"CCNGG " in string

False

string = "CCTGGAGCCCAGGGGACGT"
"CCAGG" in string

"CCTGG" in string

"CCCGG" in string

"CCGGG" in string

Regex – re.findall – exercise

• Use re.findall to find:

EcoRI_site = "GAATTC"

• sequence = "TGCATAGCGAATTCGAGCGT"

AG_nucl = "AG"

• sequence = "TGCATAGCGAATTCGAGCGT"

Eco13kl_site = "CCNGG"

• sequence = "CCTGGAGCCCAGGGAGCGT"

# Type here your code

Regex – metacharacters

Metacharacters are characters that represent one or multiple characters you want to search for in a string.

Some examples of metacharacters:

• ^ Matches beginning of line

• $ Matches end of line

• . Matches any single character except newline

• [...] Matches any single character in brackets

• [^...] Matches any single character not in brackets

• a | b Matches either a or b

• Now repeat the Eco13kl.site question using [...]

# Type here your code

Regex – exercise

Explore the regex listed using the script below, try to find out what the difference is and why:

1. CC vs ^CC

2. G*G vs G.*G

3. GT$ vs GT

4. [AC] vs [^AC]

5. GAG|GAC vs CAG|GAG

6. TGA|TGG vs TG[AG]

7. CC* vs CC+

8. CC{1,2} vs CC {1,}

9. \w\w\w vs \w\w\s

10. \d\d\S vs \d\d\D

line = "CCTGGAG123CCCCAGGTGACGT\nTGT"
find_output = re.findall("REGEX",line)
print find_output

Regex - Raw string notation

>>> find_output = re.findall("\\\\",line)

This option searches for (escapes!) (\)\ (\)\ --> \\

>>> find_output = re.findall(r"\\",line)

This option searches for \\ --> \\

line = "this\nis\na\\ntest"
find_output = re.findall("\\\\",line)
print find_output

line = "this\nis\na\\ntest"
find_output = re.findall(r"\\",line)
print find_output

Regex – other “problems” with strings

Execute the regex below, what does it find?

line = "CctGGAGccCAggGGacGT"
find_output = re.findall("CC[ACTG]GG",line)
print find_output

Regex – FLAGS – exercise

Now try to use the Ignore case flag, what does it find now?

Remember that you can also always use string.upper() or .lower()

# Type here your code

Regex – FLAGS – exercise – re.S, re.M

• Apply re.S on the example below

line = "CCTGGAGCCC\nAGGGGACGT"
find_output = re.findall("CC.AGG",line)
print find_output

Regex – FLAGS – exercise – re.S, re.M

• Apply re.M on the example below, and after that combine both the re.S and re.M flag on this example.

line = "a\nmultiline test\nto\ntest the multi\nline flag"
find_output = re.findall("^test.*",line)
print find_output

Regex – re.sub – exercise

• In the example below correct the sentence using re.sub

line = "the hedgehog is teh most dangerous animal in teh world"
# Type here your code

Regex – re.sub – exercise

• In the example below replace the two “colors” by red using re.sub and regex

line = "My computer should be grey and my car should also be gray"
# Type here your code

Regex – re.split – exercise

• Split the line below on the numbers and/including the spaces around them

• What happened to the spaces and the numbers within the output?

line = "You 1 should pay attention 2 will pay attention 3 and otherwise you will fail"
# Type here your code

Regex – re.split – groups – exercise

• In the previous exercise you could split the line, however the number and spaces itself were "lost".

• To keep the split parts of the string we can use groups

Exercise:

• Split the line again only now use ”(\s*\d\s*)" what happens?

• And what happens if you use "(\s*)(\d)(\s*)"

line = "You 1 should pay attention 2 will pay attention 3 and otherwise you will fail"
# Type here your code

line = "You 1 should pay attention 2 will pay attention 3 and otherwise you will fail"
# Type here your code

Regex – re.sub – groups – exercise

• These groups are very handy for also substitutions

• See what happens when you use grouping on the line below:

• \g< 1 > stands for group 1 = the first group between ()

• \g< 2 > stands for group 2, etc..

line = "My computer should be grey and my car should also be gray"
find_output = re.sub("(gr[ae]y)", "\g<1>blue", line)
print find_output

Regex – re.sub – groups – exercise

• Try to understand what happens in the example below

line = "My computer should be grey and my car should also be gray"
find_output = re.sub("(gr[ae]y)(\D*)(gr[ae]y)", "\g<1>blue\g<2>not\g<3>black", line)
print find_output

Regex – re.search

• example:

line = "TGCATAGCGAATTCGAGCGT"
match_output = re.search("GAATTC",line)
print match_output

if match_output:
    print "GAATTC site found!"
print match_output.group()
print match_output.start()
print match_output.end()
print match_output.span()

Regex – final exercise

• We are going to digest the DNA sequence below with two restriction enzymes

  • BamH1 G|GATCC

  • AccI GT|MKAC (M=A/C, K=G/T)

• It is forbidden to use str.split(), str.lower(), str.upper()!

Q1: How many times is each restriction enzyme found?

Q2: After digestion, how many DNA fragments are there and what is the length of each product (provide a list)?

Challenge:

Try to answer the questions in as few lines as possible: use groups and nesting

dna = "CGTGACCTTGGACCTCACTCACCATGTAGTACTCCTCTGAGAGGAATTGTACTAGAGGTGAAAACCGATAAGAAATCACAGTCTGATATGCGTGTGTGTCGACATGCATAATGTATACCCCTTACTGAGTCGTATGGGAATATCCGGCATGACGGGAGAAGCCGTAGACCAAAGGTGTGAGTGAGCATCGTTGTGAACAGTCTGGGTAAACGCGCATATGTAATGTAGTGGATCCTGACACACTCTGGACAAGGGCTCTCTGGGGAACTTGATTTTACTAATGGACTCCAAGAAGCGACGCGCACTCGGTTATGGCGCGCACACTAAAGCGAGGGATCCTAAAAGCTCATGAAGAGGTTCGATCGCTGACTAGTATGGTTATACCCGACACCGCACTGTCGCGTAGACCGCTCCTAGGATTAAATGATCACCCGCACATTGATGCGCGCGTTGCGGGTGAAAGTAGTGAACCCAAGAGTACTTGCCCGTCCGTGGCTCTAGCGTGCATACGTTACATTTTGACGCCTAAAGGTGTCTTGTCAGAGCACGTCCGGGCACAGTAGCAGATACCGGATATCTCATACGTCCGGAGCAGCGCGCGTACTCAAAGTGTGCCCAAGCTCGCATCCGAATTCGGATCCTGCCTTGCTCCCCTACACAAACTATCACGAATAAGCGCATATAAAGCGTCCACCACCTGTAACTTTACTGACCAAAGCATGTCGAGGCGATTAAAGTGGCCGTATGGACATCACAGCCCGTGCCCGACCATTATTAGCGCCGCTACTTCTCCGCGCGCATGTTGACGCTTCTGATGTAGGGTGTGCGGGTCCCAATTGATATATTTATTCGGAGTTACAAAACTGGTACAGAGGCTGTCCGTGCTCTA"

# Type here your code